Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ640369
Length 261 bp
Fasta Format > whec1h21
anagattgagctcacgcaagcaacaccatgcgggtgacttgcaggagaaa aataggctttctagattgttggagcataagaatgctttccaggaaagaat tgtccaacgtcgtgaatctgagtttagtagcctaaggaaagagagggaag aaaggattaatcagttgctatcttcaagaaagcgtgaaagggagactgta cgcaaattgatgtattttctgaacatggaggaacagcggatccaaaggga gcgtgangagc
Download
page-top