Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ640311
Length 403 bp
Fasta Format > whec1c19
agcaggcggcggtggtgcccgaagacgagaagcacggcgacctagcccga gctcgcaaccatggctaggggtttgaagaagcatctgaagaggctcaatg ccccgtctcactggatgcttgacaagcttggtggagcttttgcccccaag ccatcatctggtcctcacaaggccagggagtgccttcctctgatcctcat cctgaggaacagactgaaatatgctctcacctaccgtgaagtgcagtcta tccttatgcagcgtcatatcatggttgatggaaaggtccgcactgacaag acctaccctgctggtttcatggacatcatttccattcccaanactggtga gaactacaggcttctgtatgacaccaanggccgcttccgccttcactctg tca
Download
page-top