Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ640148
Length 652 bp
Fasta Format > whec19i21
agcctcctccgcgttcgccgccgcccgcccgcccggccgtcggatccgcc atggcttccgaccagaacaaagattcaaaatcggaggggctgtctgaggc aaaaaagggggcttccccaacaggtggtgcaggcctgcccagtccttttg atttctccaacatgagcagcttgctcaatgatccatctataagggagatg gctgagcaaatcgccagcgaccctgtattcaaccagatggctgagcagct tcagaaaagtgcgcagggtgcaggggaacagggtgttccaaatttggatc ctcaagcatacatggaaaccatgacacaagttatgcagaatcctcagttt atgtcaatggcggagcgtcttgggaatactcttatgcaggatcctgcaat gtccagtatgcttgagaacttgactagtccagctcacaaagagcagcttg aagagcgaatggcccgtatcaaggatgatccgtctttgaagccaattctt gatgagatagaacgtggtggtccatctgcaatggtgaagtactggaatga ccctgagattcttcaaaagattggccaggccatgtcattgaacttcccag tagatgctgctacttccactgtantatctggacctcaagaaactgatgaa na
Download
page-top