Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ640022
Length 610 bp
Fasta Format > whec19b20
cgctccctcactccctccttgcctctacgccgccagcggtccatgggcaa gtcaagcaagaagtccgcggcccctactgtcgtggcgccggcggccgtcc ttaccaaggggaaggccgggaagaagcgcgaagccgatgacgagatcaag aaggctgtaagcgcaaagaaacagaaggctgcgccggcaaaggcggtgcc cgggcccaaagaggccgccaagaaggccaagaagcagccgccgcccaaga aggttgagagcagcagctctgaggagcagtcatccgagtccgaggaggag gaggttcctaagaagactgcaaagcctgtcaaacacgagtcttcagatga tagcagcgacgattcctcctctgacgaggaacctgcaaagaagccttctg ctaaacctgtgaccccagctgccagcaacggctcaaagaaaggcaagcct gagagcagctcttctagttctgaggatgagtccgatgatgacgagaaacc tgctgctctggtaaagaaaacaccagccatcgaatctgacagctccgaaa gtgactcagatgatagctcagatgaggatgttcctgccaagactcctgct gctgctgcca
Download
page-top