Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ291440
Length 462 bp
Fasta Format > whsl23d02
ggccccactccgcctccgccaaaccgcaagctagggtttccgcctcgacg cggagggctcgccatggatgccgccgcccgcaagagatcccggccggagt ccgccaacggaggcgccgcaggcgggaagcgctcgagagaatcggagtca caacaaactggtctatcaagcaaatcgaagccttgcaccaagtttttcag cactgttgggtgcccctttggtgagggatgtcactttgcgcactttgtcc ctggtggataccaggcagtatcaaaatcacacagcctaggccatgctgct gtgtctgcaccgtcaagagctcctgcggatcatgctgcttctggtgtcaa aacacgcatgtgcaccaagtacaacactgcagaaggctgcaagtttggtg acaagtgccatttcgcccatggcgagagggagcttggcagggcaccatcc tcctacatgtcc
Download
page-top