Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ639282
Length 526 bp
Fasta Format > whec16f24
atggattttactgatgagagttccttttcgaaagcacttgagcttagtgg atctgacctaggtggctgcaacttgtatgttgccgaagctaagcctaagg gtcaatttggtggcgttggtggtcgatctggtggcagagatggtggccgc tctggtggtggcaggtttggccggtctggtggccgtgatggcggcggcag gtttggccggtctggtggccgtgatggtggcggcaggtttggccggtctg gtggccgtgatggcggcagaggaggcggccgaggctttcanagcagacag agtgctggcacagctagcgcagggaagaagaccacatttggtgacgatta naaactttttgagccacaaaatggtctgatgcaactgccgcgtgtctaga cgactgtatccccgtgtttcccattatcctantggacctagtatcatttg tctgtantattttcttgccgctatatgttgtaatgccanaattctactat atatgttacacctantgtttttataa
Download
page-top