Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ639199
Length 702 bp
Fasta Format > whec16b04
gtcctcaccgtgaacaagatggacagatgcttccttgagcttcaagtgga aggtgaggaagcataccagactttctcccgtgtcattgaaaatgccaatg tcatcatggcaacatatgaagatgtgctccttggtgatgtccaagtgtac ccggagaaggggactgttgcattctctgctggtttgcatgggtgggcttt cacccttacaaacttcgctaagatgtatgcctccaagtttggagttgatg aggcgaagatgatggagaggctttggggtgagaacttctttgacccagcc acaaagaaatggacctccaagaacactgggacagctacctgcaagagagg ttttgttcagttctgctacgagccaatcaagcaaatcatcgccacctgca tgaatgatcagaaggataagttgtggcctatgttgaagaagctgggtgtg accatgaagaatgatgagaaggacttgatgggcaaggctctcatgaagcg tgtgatgcaaacttggctgcctgccagtcgtgctctgcttgagatgatga tatttcaccttccctctccctcaaaggcacanaggtatcgtgtgganaac ttgtacnanggtccccttgatgatatatatgctaatgctatcanaaactg tgaccctgatggtcctcttatgctgtatgtctccnanatgattccancat ct
Download
page-top