Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ639150
Length 616 bp
Fasta Format > whec15o06
tgtggatacgaggacaagaccgaatggggaaaagagattggctggatcta tggttcagttactgaagatattcttactgggtttaaaatgcacgcaagag ggtggatatcaatctactgcatgccaccacggccttgtttcaagggttct gcgccaatcaatctgtctgaccgtcttaatcaagtgctccnatgggccct tgggtcagttgaaattctgtttancagacattgtcctatctggtacaatt acggtgggcggttgaaacttctggagagggtggcttacatcancaccatt gtttatccattaacatccctcccacttatcgcctattgtgtgcttcctgc tatctgcctcctcaccaacaaatttatcatccccgagatcagtaattatg ctgggatgttcttcattctcatgtttgcctccatctttgccactggtata ttggagctccgatggagtggtgtcggcatcgaggactggtggagaaacga gcagttctgggttatcggtggcacatctgcccatcttttcgcggtgttcc agggtctgctcnaggtgctggccgggatcgacaccaacttcactgtcaca tccaaggcgaacgacg
Download
page-top