Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ639149
Length 625 bp
Fasta Format > whec15o05
gtcatcagctgtggatacgagggacaagaccgaatggggaaaagagattg gctggatctatggttcagttactgaagatattcttactgggtttaaaatg cacgcaagagggtggatatcaatctactgcatgccaccacggccttgttt caagggttctgcgccaatcaatctgtctgaccgtcttaatcaagtgctcc gatgggcccttgggtcagttgaaattctgtttagcagacattgtcctatc tggtacaattacggtgggcggttgaaacttctggagagggtggcttacat caacaccattgtttatccattaacatccctcccacttatcgcctattgtg tgcttcctgctatctgcctcctcaccaacaaatttatcatccccgagatc agtaattatgctgggatgttcttcattctcatgtttgcctccatctttgc cactggtatattggagctccgatggagtggtgtcggcatcgaggactggt ggagaaacgagcagttctgggttatcggtggcacatctgcccatcttttc gcggtgttccanggtctgctcaaggtgctggccgggatcnacaccaactt cactgtcacatccaaggcgaacnac
Download
page-top