Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ638917
Length 583 bp
Fasta Format > whec15b07
tgcacctgaaccactagcctacctagctagctacatcggcaagtcggcag agctcgtgatcaatgggggtcaagctcacgctcccgccggcggcactgat ctcccaggtggccaagctgagctccctcctcgccctcctcctcctcgcgc tgctgctgcccgtcttcctcagggtcgcctacggctacctcctcttcaac ggcatcgtcctcgcgctcggcatccaggccttcgttggcggcggcggcgc ttccatcgccgacgacgaagaccggcacgggtctccgagtgccggtcagg ccgtcgaggcctcgccgttccagagggctggagctgaatcagtccgtccc gacgaacgggcggcggttctgggtgatcttgtcgtggtgcctgcctttgt ggcgagtaatatattcnagctgaagaccaanaccaaggangtggtgctga angtgctgaaaaantgcccgtcnacngcnancatcttcttcctcanctcn ctgaacngcngncancaanccngnnaanangaaaangnacnccanganga ngangangangannannaanattnnnaannnna
Download
page-top