Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ638851
Length 659 bp
Fasta Format > whec14m16
gtcatcccctagcctcccgccgccgtcgccgcccccgccgccacaagcga acaaggccaaagaagatggctgaagttgaaaccttcctcttcacgtctga gtctgtcaatgaggggcaccctgacaagctctgcgaccagatatctgatg ctgtgctagatgcatgcctggctgaagaccctgacagcaaggttgcttgt gagacatgcaccaagaccaacatggtcatggttttcggtgagatcactac caaggccaatgttgactatgagaagattgtcagggatacttgccgtggca tcggttttgtgtccaatgatgtagggcttgatgctgaccactgcaaggta cttgtcaacattgagcagcagtcccctgacatcgcgcagggtgtccatgg ccactttaccaagcggcctgaggagattggcgctggtgaccagggccata tgtttggatatgcaactgatgagactccggagttcatgcccctcagccat gttcttgctaccaagcttggtgctcgtctcaccgaggtccgcaagaacgc cacctgcccgtggttgaggcctgatggcaagacccaggtgactgtggagt atcacaatgacaatggtgctatggtccctatacntgtccacactgtgctc atttccacc
Download
page-top