Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ638848
Length 369 bp
Fasta Format > whec14m12
caatggcgggcggtgggctgtccggcggcgcggccgcgttctgggcgaca agagcgctggaggtggtgaagcggaacgactccccggggttgttgtggaa gcggatcaagctcaccaccacccgcaagaacaacgccaagaaacgcctaa agcgcctctggcagaacgaagcagttataagggcttctgctcaagcagaa tcatcgtcaacttcaaacacagctgccgcatctgagaaacagcagtagct tgctagtcaactcatggtttgtggtgaagaaactgatatgcagttaaaag atgggcgttgaacttgcataacatgctgaatcctaaaacacatccttccg tatatttttaaaaaaaaaa
Download
page-top