Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ638740
Length 699 bp
Fasta Format > whec14f14
gatcacatccagcagcgcaagcaagagaggagacgcgctccaccgtcggc aaccaaaccaggtacgctcgcactcggccccgtggaagatctgagctctt gccaggggactcggagctcagatcggatcggatctcgtttctttccttct ttcttcaattcaagatcccgatccccaccgccccaaacacacgcacctca ccacaccacgcgccgccgaccaagtcctctgatcacgatcccgtccatcg gctgtgttctcttcaggcaaagggcggcgatgacgttcgacaaggtggag gagctccggccgggcacctacggccacaacctccagctccgggtgctcag cgccaagcccgtcgtcctccacaggccgcagggcggcagggccggcggca acatgcgcatcgccgagtgcatcgtcggcgacgacaccggcgtagtcgtc ttcaccgcacgcaacgagcaagtggacatcatgaagcccggggcagtcgt ggaggcgaggaaggcgagggtggacatgtacaaggggtcgatgcgcctgg cggtggacaagtgggggacgctcaaggccgccgagagcccggccgacttc aaggtgaaggaggacaacaacgtgtccttggtcgagtttgagctcatcac cgtgatgcantgattgaanaangctcctcctcctcctcncctatgagga
Download
page-top