Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ638626
Length 656 bp
Fasta Format > whec13o22
ccggggagaagaccgccggcggaggagaggagacgcgggcgaggcaagag gagagtcaaatccccatcttgctcccccccccgcgccgccgaccccaccc gcggcattctctccggcgtccctcctccggccagggggaaaagcagcagc aggatggtgctgtgggtcttcgggtatgggtccctgatctggaaccccgg attcgacttcgacgagaagatcctgggattcatcaagggatacaagcgaa cgtttaatcttgcttgcattgaccatagaggcacaccacagcatccggcc aggacctgcacccttgaatccgaagatgaagccatatgctggggaattgc ttattgtgtcaaaggtggtctagaaaaagagcgagaagcaatgcagtact tggagagaagagaatgcgagtatgaccagaagatctctgtggatttctac aaggatggaaattctctggaaccagctgtgacggatgtattagttttcgt atccactcctgatccagttggcaacaaatactatccgtggccctgctgct ttggaggatatggcaaggcaaattgctacagccagtggccctaatggata taatagggactacctgttctcaatggagaaggcactgtccaatataagcc atgaag
Download
page-top