Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ638206
Length 323 bp
Fasta Format > whec12f06
gacctggggaagctcatggaggtgcacggngactacaangaggatgttgg tgtgaagcttgacaggcctgctgatggagatgaggtgattcctggagcgg aggaggttgctgctgctgagtagaaaatagaagtcgctattttgctgctt catatctagaagatgatatatgtgccacctgggtgtcgtgaactttgtag tcagttttgatggctgatttcttgagtacttctgtcgacattcctagcca gcgttcagttatcttattttgttcgtgttactttctggatggaggttatg agtttaaaactaaatatttagtt
Download
page-top