Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ638202
Length 455 bp
Fasta Format > whec12f01
ccttgttgatgttgctcacagtgctgtccgcaacgacccaaggatcaact ggctctgcaagcccgtgcacaagcaccgtgagcttcgcggactcacgtcg gcgggaaagaaattccgtggtctgcgtggcaagggccaccgccaccacaa gaacaggccctcaaggagagccacctggaagcgcaaccagaccgtctccc tccgccgctaccgttaagctgccctatgcacaccttgatagtattttgtt tgagccatcaggttttgctaccttcgttctgagactacttgaagcttgtg ctagaacctttatgtcgaggcatatctgttgaactatttgctatctgcct gtgttaccagaagaaagaatggtttagtaatcgtatgctgtgtgctatgc tgtcatatgtttgctcgttcaccttataatgttatgatgcttttcaaaaa aaaaa
Download
page-top