Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ642346
Length 632 bp
Fasta Format > whec8m17
tgttcgtaatgtgtgaggctgcgttctcttccatgtgaatctgcagaatg tgttgctgtgcttcctggggatctcattctttgttttcaggaaggcaaag agcaggccctctattttgacgctcgtgttcttgatgctcaaaggcgcagg catgatgtaagagggtgccgctgcaggtttcttgttcgttatgatcatga tcactctgaggagattgttcctctgaggaaggtatgccgtcgaccagaaa ctgatttcaggctccagatcttgcacgcatctagagcggcggcctctgcg gatgctcagaatgttagcccagttgagcagaaaccccaaaaggcgcacaa gatgatggatgtgaacactgccgaggtgaccgtggttcgcaacccagatc aaggagggccatctgacaagccggctgctcccttaccagctgcgcctgct ggcacccacggtgattcagtttcagatgtgcagatggggaatgtggaggt tattccaaaagttgaagctgcaaatgaagcacatgatgacaacatgaacg tgggagcgtanttgtttcgcttccctgtgcgcttcggtgtgtacttacta agtccaaaaaaatgtttgcttangaacttccg
Download
page-top