Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ641717
Length 685 bp
Fasta Format > whec6d15
atccccggcaagcattttgcagtctccaggaaggctgcccccaagaggac cacaaatgaactatggtggaagatttggaggaggtggtcgtggtggaaga ggacatgacgccttggttggcaagtgtatcaaaattaaatctggtcctta caaagggtaccgtggccgcgttaaagaggtgactggggtgcttgtgcgtg tggagcttgattcgttaatgaagattgtcacagttaagagggatgatatc gccgacacacctactgttgcaacaccattccgtgaaccccgattctcgtt gggtagtgaaacaccaatgcacccgtctaggacgccactacatccttttc agactccaatgcgggaccctggagcaacaccgatacatgatggaatgcga accccgatgcgtagtagggcctgggctcctatgagtcctccaagagataa ttgggaagatggaaatcctgatacttggggaagcagtccagcttaccagc caggaacaccaccagctcggccatatgaagccccaacacctggatcaggg tgggcaaatactccaggagttagttataatgacgtcccaactcctanaga gggcaattatgcgaatgctccaagcccatatgtgccttccacacctgttg gtcanccaatgacaccaaattctgctgcgtacctt
Download
page-top