Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ641612
Length 236 bp
Fasta Format > whec5m13
cactacgtcgagggcggtgatgccggcaaccgcgagaactacatcaacca gctcgtcaggaggatgaactaggttgatcatcgatgatccccttgtattc ggaagatgttttgtttgttaagcctgctttacattaggaagtggatggtg gatgcagttttgatatttcggaaccatgatgcatgtttttggaagaatgt gactatgtatgtggaggttttgagacaaaaaaaaaa
Download
page-top