Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ641338
Length 224 bp
Fasta Format > whec4l12
agtttgttggagagaaggttgcatatgcactcgctcagggcttgaaggtc attgcatgtgttggtgagactcttgagcagcgagaagctggatcaaccat ggcggttgtcgctgaacagacaaaagcaattgctgacaagatcaaggact ggaccaacgtggtcgtcgcctatgaaccantgtgggccattggcaccggt aaagttgcatcaccggctcaggca
Download
page-top