Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ641080
Length 644 bp
Fasta Format > whec3m21
gttggcataacgcataacaggcagctgtagggacatactttcaagtttca aagatcctaaaatcagaaccaaaattactaacagatatccatcgctcgat agccaaaatacagagattgttaagtcttcactccactacagaacccctgg attcctcaagacaacagtagggcaatcatgcttcggtctgctccctcaag cgacggatcgtgctcctgacggtgactgcactagcagtgttcatggtata ggcgccgccagccttgaccttgccacagtccttgcatccccaaattccaa cagctttcctcttcacagcaaacttcccacagaattcacagaagtacttg gagtgctgagacacctccatcttcttgatctgcttacgcaaactggcacc atacctggtaccatacttcccgacgattccggccttcttggtgcgcttcg tcatctcggcggcgggtagcaggaggcggctgcggcggcgtaggcgggga gatggcggccctcgtgccgaattcggcacgaggccagtacgtagcgcaag cagagtttagctcgctcccagcccggccgctcaccatgtggaccaagaag gtggcgacgcaggtggttttggtcctgcttctcctcctcatcgc
Download
page-top