Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ291118
Length 370 bp
Fasta Format > whsl21m20
aggaattcggacgaggtagcggcggcgggcggcggggcacgccggctcct gtggtgcggctcagaaactgcaactgccgcacttgccccatatatggctg ggcgtgttgcggcatgtgttgcccgccgtagggcgcgcgcgggcggcggc aagacatgcgctgcaagctcgcacctttgcttctctctgttgaaggtttg aataacgtacacatgtagtacggggttacatgtgtctctgctgctgtttc aacggtagtagtggtcgtggtcgtcgttgtcatcgtcagtggttctgccg acgatctttacagtttgatttactagtatatcaagcttaaatggacgaaa atgcttcttcaaaaaaaaaa
Download
page-top