Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ638036
Length 711 bp
Fasta Format > whec11l09
cctgctgctctggtaaagaaaacaccagccatcgaatctgacagctccga aagtgactcagatgatagctcagatgaggatgttcctgccaagactcctg ctgctgctgccaagaaggtagattcttcagacagttctgagtcggagagt gaatctgaggatgaggagaaatcaaagaaagccgcacaggccaccaagat agctcctgcagctgctaaaagaaaggaggagcccagtgattcctcagaca gtgatgagagtgatgaagagcctccccagaaaaagctgaaggatgctgcg aaggttactcctaagtctgccaaaaaggacagcaccagtgatgatgacag ttctgatgaaagctctgatgatgagcctaaaaagaaagttacaactgcca caaaatcacagaaggaagagcctaaaactcctgctagcaacaaaggtcag gcaacagggtcgaagaccctttggatggggaacctttccttcaatattga gtatgatcaagtgaagcaattttttgcacaaattggagaggtcgttgatg ttcgcctggctacccatgaagatggccatcccaagggatttggtcatgtt gagtttgctacggctgaagatgctcanaaagcgcttgattcactgaatgg tggagatctaatgggccgtccggtgagacttgacatggctgctgaaagag gtgcaactcct
Download
page-top