Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637895
Length 558 bp
Fasta Format > whec11c20
tcgcctcccaagatcgcagatctgctccggtgagaatccgtcgccatgtc ttccagcgaggtcgcctgcacccttgccgccctcatcctccacgatgacg ggatccccatcacttctgagaagatcgcgacggtggtgaaggctgccgga atcaaggttgaggcctactggcccgcgctcttcgccaagctcctggagaa gaggagcgtcgatgacctcatcctttccgtcggatctggtggaggtggtg ctccagctgctgctgctgctgccccggctgctggtggtgctgctgccgct gaagagaagaaagaagagaaaaaggaggaggctaaggaagagagcgatga tgacatgggcttcagcttgttcgactaagcagttcaattccagttctcct gtggaatcttttatgctaaggattacttatcttatgtgcttttaggtcga attttgcggatttaatatgtttgagacctaagtatctgtgcaatgagtac tgcaaaccaccttgggatggtctttttanaatgaaaatggttttggtgct tggttgaa
Download
page-top