Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637696
Length 759 bp
Fasta Format > whec10g04
gtggatctaataaacaagatgtcttaggtttgaaagcaacatgcagataa ggagataactttggatatgttattatctttaccattatacgtatataatt tcttaatgtacgatggagctgacctcacgggttgactgacggcgacacga aagttggagggagccaaccatctctacggcccatgctcctcttgccaacg atgaccgcgccgtgaaccagggctgccgctcgagctcctcctgggtccag gtcatgctatgttttagtgctcatggagttcctctggcatacgttggttc tggtgatccgtataaaacatagatggaagactatggatcttatcatggat gagctcaaagatacaggaatctcaaatccatggacaagcacatgaaatta tatgttgtggtagatttcaaaagagacccagggcccagagtagttttgca aaaatggaggataccagactgacccatggagcatgagatcctccttgtca ggggccaccttacttgtatggcttcaggctgaggagacccttctaattaa gatttgtgctgctgctattgcgttcttcagtttctggtcattggttcatc tgcaaatgtgtggacctcactcccttttgctcgattgctccaccttgctc ctttggctgattataatagctatttccgcagcccatgacgatggttgana gatccaggcagcgtccanattgctgttatcatcctccatcaacaaaacca tgggggtcc
Download
page-top