Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637694
Length 660 bp
Fasta Format > whec10g02
gttgtgggctcatgtaacggataacatcttgagcacaaggagcccagaga tcaccatcagcagactcaaaatcagattcctcttggtgcaacctgactgt tacacaattggcaaatctgtcgcccatgccatggcaacacagaaggttgg cgcggctgagtttcagatcgtaacagacaagactcatttgatgtgctctc ctgccgatctcctcgaccatgcaaagcagctcaatgatttcttcggtgct tgtcgtgatgcatttgctggcctcaggcgcctgtggctgtgcaatatgag gtttggtggtgaactggacatacccaacatcctcagcacttgcaagctct tggagtctttgcgtttaacccattgcgactctgggatgaattctgtgctg caactagaacatgctcagcttaccgagctcaaggtcgactatgggaaatt tgagatagttgagctgacatgtctaccgaaactccaacgggtgagctata agagttggttctactctgagaaagatcccctgtattttggttttgtgcca cagctttcaaagctgaggcttgctaaaactggctccagatcgactangac tcttgagttaantcanctcctcggtaatgttccttccataancgatctgc atctggattt
Download
page-top