Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637693
Length 722 bp
Fasta Format > whec10g01
tttgggagggcggcaacgcagacccatctcccccaaatccatcccgcggg agacacgagcgtgcgagggagagaggccgctgctcgccctggtcccggtg ggatgaagattgacgatcccctcgacttcgagggggataacgaccccctc ctcaccgtccgccgccccgccaagaggaagaaggttattgagctggatga tctcgtagaagattactttaattccggtaaggatgagctcaaagcttctg ctgctaagtctaagggtcgccccaaaggagacaattcagatgatgaagac aagcaggtcaggaaggagattgacttctgcaaatttgtggaggagtgtga ggagaaggcgaaagcgatggatcctggagaggatgtaccccaatggggcc agcaagttttcggctgtcagaaatcaccctcaggtcttaatggcacggga gttgaaaattgccaacttttgcaatcattctgtggagataagcagttagg ttttgatctanaaattgaacgaggagagggctttttanaaggcatgctga tcaatggatggcttttgaagttggtactcctatatggttctgttgaagac tctatagcatcatgggtgctaaccaagttgctgtactcatccaataanaa nttgcaagattctgcatctgaattttgggatantctcctttccctaaatg angatgataaaccattggtaaa
Download
page-top