Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637692
Length 519 bp
Fasta Format > whec10f22
ccgatcaccggcggcggcggcggcggcggcgatggtgtgcaccaagtgcg agaagaagctggggaaggtgatcgtcccggacaagtggaaggagggcgcc agcaacacctacgagggcggcggccgcaagatcaacgagaacaagctcct ctccaagaagagcaggtggactccttacggaaataccaaatgcataatct gcaagcaacaggtgcaccaggacggtaaatactgccacacctgtgcctat tcaaaaggggtgtgtgcgatgtgtggcaagcaagtgctggacacgaagct gtacaagcaaagcaatgtgtgagcaggatactcaagtggtggacttggta tgtttaacatgtaagatcatgacatcatgtactagcgatattgctgtgga aaaaggtgttgtgtgcgtgttatgaaaagagcaatttttaacagttgtgt aaacgggcgtggttgtctctgtaatttgcacccttgagcaatgtggattt ttgctgcccnnnaaaaaaa
Download
page-top