Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637675
Length 669 bp
Fasta Format > whec10e23
aggagccactccggtcagtgtggcgtccggcacaacgaccccgggaaggg agttcccgagcagtgcagcgtccgtcacaacgaccccgggaagggagttc ccgagcagtgcggcgtccgacacaacgaccccaggaagggagttcctggg tagtgcgatgtccgacaagtcatccccgagaagggagttcccgggtagca tgacgtctgacacgatgaccgcgggaagggagttccatggcattgtgacg tcaggaactacgaccccaggaacactgacgcccacaggcgaggtggttcc ctggcagttcatgtccctgccaacatcgcggtcggacttgttagatgcca acaaaaattgtggcgatccacacaggttccgaagcctaggtggaccttct cggcgaacctgcgggacgaccgcagcatcccgagatcaagaagcacgagt aaggcgtatgggctacacaaagcctgagaagacggacatcccnacgaagg cacttggtcgcattcngttccaggaaccacgcgacnagattgggatcatg gaaacaagctccttcgacaaggttgaggaggagattgttgggtcaaacct tgtctccnaggcatggctacagcggcagcancagcttgcatgcaacggca gtantanttattactcagc
Download
page-top