Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637674
Length 611 bp
Fasta Format > whec10e22
anagcagctcggcttgcagatcgagagtgagggagtgagaggcaatggcg acttcgttccaggggacgaccaccaagtgcaacgcctgcgacaagacggt gtacctcgtcgacaagctcaccgccgacaaccgggtctaccacaaggcct gcttcangtgccaccactgcaagggcaccctcaagctcgcgaattacaac tcgttcgaaggagtgctctactgcaggcctcactttgaccagctcttcaa gaggaccgggagcctcgacaagagcttcnaaggcactccaaaggttgtca agccggaaaggaatgttgggaatgagaatgctattaaagtctcgagcgca tttgctggcaccagagagaaatgttttggatgcaccaagacagtctatcc aattgagagggttactgtgaacaacaccatgtaccacaagagctgcttca aatgctgccatggagggtgcaccatcagcccttcgaattacatcgcgcat gagggcaagctcttctgcaagcaccaccacacccagctgatcaaagagaa gggcaatttcagccagctcgagaacgatcacgacaaagacgtcacagaag tgccgggtcag
Download
page-top