Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637672
Length 703 bp
Fasta Format > whec10e18
gccgactcctccctccaacctttccccaccatggcgtcgccctccgtctt cgccgggatcgcgcagggcccggaggaccccatcctcggggtgacggtcg cgtacaacaaggatcccagccccgtcaaggtcaacctcggcgtcggcgcc taccggaccgaggaagggaagcccatggtgctgaatgtggtcaggcgcgc cgagcagatgctgatccaaaacgagtcacgtgttaaggagtacttgccga tcactggattggcagatttcaacaagttgagtgctaagcttatcttcggt gctgacagtcctgctattcaggagaatagggtggctactgtgcagtgctt atcaggaactggttccctacgagtgggaggtgaatttcttgcaaggcact atcatgaacgcacaatctacattccccagccaacctgggggaatcaccca aaagtcttcactttagctggcctgactgctaggagttaccggtactatga tcctgcaacttgtggactggatttccaaggactcttggaagacctcagtt cagctccctcaggcgcaattgtactgcttcatgcatgtgcccacaaccct actggtgtcnacccaaccttggaacagtgggaacagatcangcagcttat ganatcaaaagcattgctgccattctttgacagtgcttatcaaggaattt gca
Download
page-top