Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637669
Length 753 bp
Fasta Format > whec10e15
gtattgtaatattcacgtttcatataagcaagtatcatctaaacatattg ccaacaattcctgcagcaacgcgcggggaattgtttagtttttacaatac atggttaacattctttctatacacatttaatatttttgaaatgcttggtt aacatttttaaatacttgtttagcattttttcaaatggtggattaacatt tttatatacacgatcaataaaattcgtcatttttaatacatggtcaaaaa aaattatacacacatttaacatttttcaaatgcttgattaatatttttca aatacttgttcaacatcttttttgaatgcttgattaatatttttatatac atgatcaagtttttgttgaaatacttgttcaacattcttgaaatactatt tcaacatttttcaaatacttgttcaacatgtttcaaatgctttttgtaga ctgtcttttatatacatgatcaaaatttattgaaataccggttcaacctt tttcaaatactttttaaacattttcaaatacttgttctacatattttatt ttgaatgcttgattaacatttttctatacatgatcaacatttttaaatac ttgttcaacatttttaaataattattcaacatgtttcaaatgtttttgta gactttttgtaatatatatatatatatgtgtatttaaaatatttgaaagt ataaacaaaagtacaaaaataaagcaaaaaacgaaatcagaaaacctaaa aaa
Download
page-top