Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637666
Length 718 bp
Fasta Format > whec10e12
gggcgacgtcgccaacctcaagtgccgggtccgggccgtcaagaaggccg aggtcgacagccctgtcgcgatacagaccatcaaaggttacctcttggtg gccagccaggacaagatcatggtgtacaacacctcatctcagtactatgg gagggtcggggcgccccggccgctgttcaccactgccattagggacatca aggctgtgtttgcgggttctagcgccgtcatgtcagccgcaccagctggg aagcctcttattgccgcggaccgtgagaagctcgtcatcttggggcttgg ggatggttacatcgccatctaccgttccaacttcccggtgtacaagccgg agagcaatgctgttgtgtggagtggcccggcgctgcttttcctcctgttc ttgattggcatctggcaagtctatgtgaagaagaaggattcgttgggatg gacaccggaggagacgtttaacacctcggtcacagctcctacagggagca tcttgaatcatccagccagtgagcgagcattcgcagatagcacgacaaga gctgctgatcgaagctatgtggatggcacgaccagagccagcgacagaag ctatgtggacgccactgcgagatctactgaccgagcctatgctgaggcta ccagggctgtggacctacgcggcggggcgttgagaagtgctccganaagg tatgtgtcccctaccagg
Download
page-top