Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637659
Length 718 bp
Fasta Format > whec10e02
tgttcccatctctgggtttgagggtgacaacatgattgagaggtccacca accttgactggtacaagggccctacccttcttgaggctcttgaccagatc aacgagcccaagaggccctcagacaagcccctgcgtcttccccttcagga cgtttacaagattggtggcattggaactgtgcctgttggccgtgttgaga ctggtgtcatcaagcctggtatggttgttacctttggtcccactggtctg acaactgaggtcaagtccgttgagatgcaccacgagtccctcctggaggc gcttcctggtgacaatgttggcttcaacgtgaagaacgttgctgttaagg atctgaagcgtgggtttgttgcatccaactccaaggatgaccctgccaag gaggcagccaacttcacctcccaggtcatcatcatgaaccaccctggtca gatcggcaacggctacgccccagtgctggactgccacacctcccacattg ctgtgaagtttgctgagctggtgactaagatcgacaggcgatctggtaag gagctggaggcgctgcccaagttcctgaanaacggtgacgctggtatcgt gaagatgattcccaccaagcccatggttgtggagaccttcgccacctacc ctcctcttggnccgcttcnctgtgcgtgacatganacaaacggttgctgt tggtgtcatcaanggcgt
Download
page-top