Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637657
Length 668 bp
Fasta Format > whec10d23
taccgcaaaaccctcctccccgttcctcctcctgctcgcggccgcggcgc tctacccagccgccgccgacggcgacgaggtgcttgccctcacggagtcc accttcgagaaggaggtcggccaggatcgtggcgcactcgtcgagttcta cgctccctggtgtggccactgcaagaagcttgctccagaatatgagaagc ttgctgcaagttttaaaaaggctaaatcagtcttgattgccaaggttgac tgcgatgagcacaagagtgtgtgcagcaagtatggagtttctggctaccc cacaatccagtggtttcccaaaggttccttggagcccaagaagtatgagg gtcaacgcactgctgaagcccttacagaatatgttaactctgaagcagca accaatgtgaagatagccgcagttccttcaagtgttgtggttctgaccga ggaaacctttgactcggttgtccttgatgaaaccaaagatgtccttgttg agttctatgccccatggtgtggtcactgcaagagtcttgctccgatatat gagaaggtggcctctgttttcaagcaagatgagggtgtcgtgattgctaa tcttgatgcagacaaatacacaagcttggctganaagtatggagtttctg gttttcccacattgaagt
Download
page-top