Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637646
Length 419 bp
Fasta Format > whec10c21
gctcccccgaggcggcggngcgagcgagcgagcaaccggnggcnatgggc aangcggcgaagagctcncggaaagggaagaaggcgtggcgctccaacat cagtcaccgacgacatcgtacgagttctactnagaagcaggacgcgcgac gcccacgccggcgccgccgccatcccctccctcccgtccgactccctgtt ctttgtcgacaagcccgcctccgcgtcctcgtccanctcctccgccgcca ncgcaaacgcctccgaccctgcccccaaagatgttcctgtcaaaaggaag attgagaaaaacanggagaaggtccttcaccatgagagtgtgttgaagcg gaacccttatatacagacaattccatcttctttgatgtcaaagaaggaca agangaagttcaagaaaca
Download
page-top