Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637645
Length 606 bp
Fasta Format > whec10c18
gacttcaaggacgatgtanattgtcgaaggcaaagttgcagagtgcatgg gcagcagtaccagtgcaagaacctcgcgcatgacggagctgctgtggtag agaagcaaaacccaacgactaactctacaagctctggtcgctgtcttaaa catcactaacggctatatgtcttctgatcgtcttgatggcatatatgagg acctgcaatactgaacctggaagttagtcgttgaggcagtggtcatggta gtgatatctactgccagaacataaacgtttggccctccttgttgccacga aggattatgatctactggatttacagaaccagttaatggcatgatgctgg cagtagtaatggagggttgtgatttctggatggacggattggcgtcctct tctcacgaaacacactgacacaaaatttctggtttctgacgtacaaggat tatttactatgaacaaatattgcaatgttcattcgtagtactgtttgttg aggcgatgcctctcctacaggcgcgaagaggaaggtggggacacgccatg gcagaggccagtgccgaatctacgtctgctggcagaggcgcgtggttgac aggagg
Download
page-top