Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637644
Length 731 bp
Fasta Format > whec10c17
agagcaccgggacttcaggacgatgtagattgtcgaaggcaaagttgcag agtgcatgggcagcagtaccagtgcaagaacctcgcgcatgacggagctg ctgtggtagagaagcaaaacccaacgactaactctacaagctctggtcgc tgtcttaaacatcactaacggctatatgtcttctgatcgtcttgatggca tatatgaggacctgcaatactgaacctggaagttagtcgttgaggcagtg gtcatggtagtgatatctactgccagaacataaacgtttggccctccttg ttgccacgaaggattatgatctactggatttacagaaccagttaatggca tgatgctggcagtagtaatggagggttgtgatttctggatggacggattg gcgtcctcttctcacgaaacacactgacacaaaatttctggtttctgacg tacaaggattatttactatgaacaaatattgcaatgttcattcgtagtac tgtttgttgaggcgatgcctctcctacaggcgcgaagaggaaggtgggga cacgccatggcagaggccagtgccgaatctacgtctgctggcanaggcgc gtggttgacangaggagccggggaggcatgacggtggacatgtggatgtt atcntggcattgacacatttcnccctaccaacactgcataccaacntgac tgaatgttatcntggcttanatgccctatca
Download
page-top