Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637639
Length 718 bp
Fasta Format > whec10c12
agaccaggagcgccctctctcccccgccccctccccccaggaaaccagcc atgaagggggccaaatccaagggcgccgccaaggccgacgccaagttggc ggtgaagagcaagggggcggagaagccggccgccaaggggaagaagggca aggccggcaaggaccccaacaagcccaagagggcgccatccgccttcttc gtcttcatgggcgagttccgcgaggagttcaagcagaagaaccccaagaa caagtccgtcgccgccgtcggcaaagcggccggtgagaggtggaagagct tgagcgaatcggaaaaggccccctatgtggccaaggccaacaagctcaag ggcgagtacaacaaggccattgctgcctacaacaagggcgagagcgctgc tgctgctgccccaaagaaggctgcggccaaggaggtagaggaggaagatg aggaggaatctgacaagtccaagtcggagatcaatgacgacgatgacgat gagggcagcgatgaggacgaggacgatgacgagtgaagaagacgcatctt gtcaaggctgctccggcggacaagtcgggagctgctgtgcgagaacggac ctgagctgtgtgcggtggtgtcataaggagcctatccatctccactanaa ttatcccaagtttcacttcacatcgtgatgttgttttacctttttcctgt cattgtcctgctataacg
Download
page-top