Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637630
Length 469 bp
Fasta Format > whec10b24
atgtgttcgatgaagcagatgttgagacagcagcagaagcgctggacgat atgccgatcaagaagctgtacacgcttgtcgagatggctgcgcaggggcc acaagggggaagcgcagaagccatctatgccggagaggaaaagatagacc tcaaccatttctttagcatcttgagcgacatcatccgctactgatcacac atacatttgaggaccctaggctccactataggaatttgtttactccagtt tccccagcttgctatcttcacagggtagagtggtttgatcccgagtggcc ttttattgtcacggttcggcgagagttgtgtctttgctatgcttccgtcg atataaatattctattatctgaagcctgagggcttgttttgtttgagacc taggcgccgtgcctgagaaatatttacctggccatgctatttggtgaatg gtgttgttgaaaaaaaaaa
Download
page-top