Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637628
Length 318 bp
Fasta Format > whec10b20
cgcatacacctgttgtgcacatctctgctcttcctgagggcaccgattgc ggtttcnacatagtaagaagagcagcacggctggatcatncgaaagagat ggcattttcctctgaccacactcactcttgacattctaccattgaaagat ctgtggtttacttcagctctggcaccattgagggtgtgcgctaattttct ttggcaactattgtggcaaaggctgtagcttccanagtgctaatgcgaaa gcctaagacttcaagtgttattgcttcccttgtgataccctaataataaa tgcatttggcgacttaaa
Download
page-top