Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637626
Length 614 bp
Fasta Format > whec10b18
atgactctctgaagccagttctcctcactggcactctccaggacaacttc tttgccagctttgctcttggttggttgatcaccaacggtgcaggtcttgc atcttaccccattgacaccgtccgcagaaggatgatgatgacctctggag aggctgtcaagtacaagagctccttggatgctttccagcagatcctggcg aaggagggtgccaagtccctcttcaagggtgctggtgccaacatcctccg agccattgctggtgctggtgtgctctccggctatgatcagctccagatcc tcttcttcggcaagaagtacggctcaggcggtgcctagacgggaagaaat gatgacgaacaagagaagtctgttcccagtcctgcccttcgaggatctgg cgaacttttatctttttaacgttggaaggcaataatttctgtagagggtg gattttcccaacattcgtttttggtggaggcatcnaactccanaggttgt cgtangttggcggcancgttctcaaaacatttactatcatangggttgan tttgantccnannatntgccctgaatcnnnactgnnnaattttccttana tannttgncctcna
Download
page-top