Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637621
Length 690 bp
Fasta Format > whec10b09
tttacattacattcgtataaatccaaacaaattatgtcgatcgtcctggt cccacgctacacacctaattcttgcgtgtggacggagaagcacttgattc agctgtaatttattttttcaccctaatttaactaggaatatagtagaaat aattcagacacgcatagagattgggacgatcactgagactcccaggcgcc gagcgcgcgcctgggcgtgggcttgggtttgctgtccgtcttgacggcgt aggatgcctccatggcgatgccgcagagcccgccttcggcaccggaatcc ttctccaccctgatgtaccccttctccccccacgacgggccccacgagtt cttcaccgtccagtacgccttgccgtcctccgccacgccgtacccgacca ccgcgacgccgtggtccagctctgttccacactcaccggtgaacaccccc tcggagtagaacatgaacgccttcccgctggcatcgatgcccacggacac gggctggttcgccacggccttggccagcgcctcctcgctgttggccggca cgtcctggtgtccgtcgatgtgcacctcgtgccgaattcngcacgaggcg ccgccgacgaantccccantccacctcnccaccacctcccanccgcctcg tgccctatcntgctgctacactacatttcctctgataatg
Download
page-top