Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637619
Length 719 bp
Fasta Format > whec10b05
ccctccgcccgacgcttccgcgtctccctcgccggccgcgccaggagccc cgtcattgcgatggcttccgccaaggaagggaacggtgcggtgacgaaga ggaccacgctccatgacctctatgagcaacagggtcagtccccgtggtac gacaacctttgccggcctgtcaccgatttgctgccctacatcgccaacgg tgtccgtggagtcaccagcaacccaacgattttccagaaagccatctctt catcaaacgcctatgacggtcagttcaaggagcttatatcagctgggaag gatgcggagagcgcttactgggaactcgtcataaaggacatccaagacgc gtgcaagctgtttgagcccatctacgacgagactgatggggctgatggtt acgtttcagtggaggtgtctcctaggctggcaaatgacacccaaggaacc gtcgaagctgcgaagtggttacacaaagtggtcaaccgccccaatgtgta cataaagatcccagctacagcagaatgtgttccttctatcaaggaagtca ttgctaatggcatcagcgtcaatgtcactcttatcttctctgttgcaaga tacnaggctgtgattgatgcttacctcgacgggcttgaggcttctggttt gagcgacttatcccgagtaaccantgtancatccttctttgtcanccgag ttgacagtctgatcnacaa
Download
page-top