Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637617
Length 714 bp
Fasta Format > whec10b03
actcgatgagtccttgaaaaaggatttcatccgtcctaggttcgtctcca tgggcttgtcccgtccttttcgtcaagaagaaggatggtacggatcggat ggttgtagattatcgacccgttancttggncacaataaagaacaagtatc cgctccccaggatcaacgacctatatgatcagctcgctggatcctcagtc ttctctaagatggatttgaggttgggctaccattaaatcaaaatcaagaa tggggacatctctaaaacggcctttgttactcgtcatggccaatacgagt acactgtcatgtccttcggtttaaccaatgccccaaccactttctctcat gttcacgtgttactaatcagtagtaccttatatgattgatggatacaagc ctagttcagttctactaccccattatgttgctaaaatggattcagaatct tgatatgatgttgttagtgtctatgcaatcctttgcaaagtgtctcaaaa tcttgatatgatgttgttgagtgtctattcaatgatgactattatgcggg ctagaactggcttgctttggaacactgacttccgctatatgccagcgtca ctccctggggcagaaggttatttcacagctatttacaccgactctcatca tgaggactcgctacttcgcactaccgcacagatgcttgaggataaggacc gtgaaaatcgtgcc
Download
page-top