Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ637604
Length 602 bp
Fasta Format > whec10a09
aagaatcgatgcctgccgccacaatcggccatgagaacaccggctgctat atcctcgccgccctctaccgctcgcgccacgggcgtcgatccagccgggg cgcagtcgcggctggtggtgccatcgtcgtccggcaggaccatccccgag cgcctcccatcaaaggatccagcgtccatgtctggtgtcgggccccctgc tatggcggcctcgagtgcttggtgccggtggtgtcgtcgagccaagcgcg ctggagcgcggcaacgatggcacggtggtgctcggcggagttgagggcaa gctagcgcgcgagcagctcctcgaggccccgtgataatctccgccatgct cttcaggaagtcctccttcgagtccctcggctccttcaccacaacgaggc tctcctgcagccagcaccgccgcctctgccgcatggtggtcaccaccggg ggctgcacgtccgctggccttctccccttcanctcgctgctcggcttcac ntatggttcnccgtcnctgcctcnccctggncatcngtcnctggctgang tctcctcctccctgtcnaccttctttgnnnngnttgnntcttgnggtcnc ct
Download
page-top