Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ526850
Length 711 bp
Fasta Format > rwhdp20n17
cgaatccgacagggtccacgccacataaaattaggcgggggatatacatg ggcctggtgaagcactcacaacaacgaaactcccctccgacaaatctaat tttcaaaagttatgtaacaagaaaaagagcgagagaaaggaagaaatggc tgcgactcggctcctatggtgtgcacaggttcttcaggtcttcctccttg gcgtacgagttcgggatgagcctcgcggcgtaggggtacaggtccttgta tgaattcctgatggtgccttctgccactccggtggccaaggagatatctt taagtggctttttgtcctctgaaagctgggttatcatataaatgacagca gccgcaattgaaataggactcctccttatatcaagctcctctgagcgctg aactgcctcctgagctgctttaacagcagtattgttcatcccaagagttg aacagaaacgcctcaggaaatctccagcatggatggttcccatctccata gattggcccatctcaacttccagctgtttcactatgaactcttttgctcg accaatctctttctttgttgctccattggcaactgagcaaatttctttta cagtcctaggacgatcttcttgtctacaagcaatatacagacaagcagct aatatagcatcttgatttcttccccntgatanacttgagatcttccncct tcttatanatt
Download
page-top