Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ526235
Length 755 bp
Fasta Format > rwhdp19l01
agcataacacttgaagtcttaggctttcgcattagcactctggaagctac agcctttgccacaatagttgccaaagaaaattagcgcacaccctcaatgg tgccagagctgaagtaaaccacagatctttcaatggtagaatgtcaagag tgagtgtggtcagaggaaaatgccatctctttcgctgatccagccgtgct gctcttcttactatgttgaaaccgcaacggtgccctcaggaagagcagag atgtgcacaacaggtgtatgcgattttaatggtatgtcggagccggtaac cttcttctccgtcgacctgctcagcaccttcctcacctcatccgcaagca caatgatcgagtcgtcttcatggcttatattggacagtgccttctccatt gagaacaggtagtccctattatatccattagggccactggctgtagcaat ttgccttgccatatcctccaaagcagcagggccaagatagtatttgttgc caactggatcaggagtggatacgaaaactaatacatccgtcacagctggt tccagagaatttccatccttgtagaaatccacagagatcttctggtcata ctcgcattctcttctctccaagtactgcattgcttctcgctctttttcta gaccacctttgacacaataagcaattccccagcatatggcttcatcttcg gattcaagggtgcaggtcctggccggatgctgtggtgtgcctctatggtc aatgc
Download
page-top