Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ525982
Length 728 bp
Fasta Format > rwhdp18m11
gtctcataacatccagggtttcaccaaagcttacattaggacagtatgta aggcacaagacagacaccaccaagggcacgatatgcagcgctaacagctg aacagctaaaatatacccagtacgaacaatgcccttaacaaaactcagcc aatactaaaaactgcttggtgtctgaaacagtgatttggatatcaattgt ggaattacttcttcttgatggcagccttggtcaccttggccccggttggg tccttcttctcaacgcccttgatgacaccaacagccacagtctgcctcat gtcacggacagcaaaacgaccaagaggagggtaagtggcaaaggtctcca caaccatgggcttggtgggaatcatcttcactatgccagcatcaccattc ttgaggaacttgggcagggcctccagctccttaccagaccgcctgtcgat cttggtcaccagctcagcaaacttgacagcaatgtgtgaggtgtggcagt ccagcactggggcgtagccgttgccaatctgaccagggtggttcatgatg atgacctgggaggtgaagttggctgcctccttggcagggtcatccttgga gttggatgcaacaaacccacgcttcanatccttcacggcaacgttcttga cgttgaagccaacgttgtcaccaggaancgcctccaggagagactcatgg tgcatctcaacggacttgacctcanntg
Download
page-top