Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208637
Length 662 bp
Fasta Format > wh10b08
ttcggcacgaggcacgggnaagggaggcggaactcgggnagaggagatgg gtgcgccgaagcagaagtggacgtcggaggaggaggaggcgctgcggcgc ggcgtgctcaagcacggcgctggcaagtggcgcaccatccagaaggatcc cgagttcagccccgtcctctcctcccgctccaacatcgacctcaaggaca aatggaggaatttgagttttagtgcaagtggactgggttcaagggataaa ctaagggttccgaggccgaaagcaccttcgtcctccccatcacctagccc gcagcttctgcttctctcagccccgaataatgttgccgaggcttctccac cagaagattgtgaaaaaagcccacaggatgacaagactccgagtccaaag ttgtcttacttaagccatatgcctttaaactttcgttacaaaacatatac ttttaagcgtctgcttattctggaagacaagcatagtactattaattcaa tacttctattcaagagttagtgcatgatcacgtgatacatctaggacgtt tctactcatcccatgttagataaatctactcttatatttctttccattag aggaatatatgattctgtctaatgatcacgagatgaattttcaaacaaag cagtaggaatga
Download
page-top